Home > Tutorials > perlretut

• NAME
• DESCRIPTION
• Part 1: The basics
  • Simple word matching
  • Using character classes
  • Matching this or that
  • Grouping things and hierarchical matching
  • Extracting matches
  • Backreferences
  • Relative backreferences
  • Named backreferences
  • Alternative capture group numbering
  • Position information
  • Non-capturing groupings
  • Matching repetitions
  • Possessive quantifiers
  • Building a regexp
  • Using regular expressions in Perl
• Part 2: Power tools
  • More on characters, strings, and character classes
  • Compiling and saving regular expressions
  • Composing regular expressions at runtime
  • Embedding comments and modifiers in a regular expression
  • Looking ahead and looking behind
  • Using independent subexpressions to prevent backtracking
  • Conditional expressions
  • Defining named patterns
  • Recursive patterns
  • A bit of magic: executing Perl code in a regular expression
  • Backtracking control verbs
  • Pragmas and debugging
• BUGS
• SEE ALSO
• AUTHOR AND COPYRIGHT
  • Acknowledgments

NAME

perlretut - Perl regular expressions tutorial

DESCRIPTION

This page provides a basic tutorial on understanding, creating and using regular expressions in Perl. It serves as a complement to the reference page on regular expressions perlre. Regular expressions are an integral part of the m//, s///, qr// and split operators and so this tutorial also overlaps with "Regexp Quote-Like Operators" in perlop and split.

Perl is widely renowned for excellence in text processing, and regular expressions are one of the big factors behind this fame. Perl regular expressions display an efficiency and flexibility unknown in most other computer languages. Mastering even the basics of regular expressions will allow you to manipulate text with surprising ease.

What is a regular expression? A regular expression is simply a string that describes a pattern. Patterns are in common use these days; examples are the patterns typed into a search engine to find web pages and the patterns used to list files in a directory, e.g., ls *.txt or dir *.*. In Perl, the patterns described by regular expressions are used to search strings, extract desired parts of strings, and to do search and replace operations.

Regular expressions have the undeserved reputation of being abstract and difficult to understand. Regular expressions are constructed using simple concepts like conditionals and loops and are no more difficult to understand than the corresponding if conditionals and while loops in the Perl language itself. In fact, the main challenge in learning regular expressions is just getting used to the terse notation used to express these concepts.

This tutorial flattens the learning curve by discussing regular expression concepts, along with their notation, one at a time and with many examples. The first part of the tutorial will progress from the simplest word searches to the basic regular expression concepts. If you master the first part, you will have all the tools needed to solve about 98% of your needs. The second part of the tutorial is for those comfortable with the basics and hungry for more power tools. It discusses the more advanced regular expression operators and introduces the latest cutting edge innovations in 5.6.0.

A note: to save time, 'regular expression' is often abbreviated as regexp or regex. Regexp is a more natural abbreviation than regex, but is harder to pronounce. The Perl pod documentation is evenly split on regexp vs regex; in Perl, there is more than one way to abbreviate it. We'll use regexp in this tutorial.

Part 1: The basics

Simple word matching

The simplest regexp is simply a word, or more generally, a string of characters. A regexp consisting of a word matches any string that contains that word:

    "Hello World" =~ /World/;  # matches

What is this Perl statement all about? "Hello World" is a simple double quoted string. World is the regular expression and the // enclosing /World/ tells Perl to search a string for a match. The operator =~ associates the string with the regexp match and produces a true value if the regexp matched, or false if the regexp did not match. In our case, World matches the second word in "Hello World" , so the expression is true. Expressions like this are useful in conditionals:

    if ("Hello World" =~ /World/) {
        print "It matches\n";
    }
    else {
        print "It doesn't match\n";
    }

There are useful variations on this theme. The sense of the match can be reversed by using the !~ operator:

    if ("Hello World" !~ /World/) {
        print "It doesn't match\n";
    }
    else {
        print "It matches\n";
    }

The literal string in the regexp can be replaced by a variable:

    $greeting = "World";
    if ("Hello World" =~ /$greeting/) {
        print "It matches\n";
    }
    else {
        print "It doesn't match\n";
    }

If you're matching against the special default variable $_ , the $_ =~ part can be omitted:

    $_ = "Hello World";
    if (/World/) {
        print "It matches\n";
    }
    else {
        print "It doesn't match\n";
    }

And finally, the // default delimiters for a match can be changed to arbitrary delimiters by putting an 'm' out front:

    "Hello World" =~ m!World!;   # matches, delimited by '!'
    "Hello World" =~ m{World};   # matches, note the matching '{}'
    "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                 # '/' becomes an ordinary char

/World/ , m!World!, and m{World} all represent the same thing. When, e.g., the quote (") is used as a delimiter, the forward slash '/' becomes an ordinary character and can be used in this regexp without trouble.

Let's consider how different regexps would match "Hello World" :

    "Hello World" =~ /world/;  # doesn't match
    "Hello World" =~ /o W/;    # matches
    "Hello World" =~ /oW/;     # doesn't match
    "Hello World" =~ /World /; # doesn't match

The first regexp world doesn't match because regexps are case-sensitive. The second regexp matches because the substring 'o W'  occurs in the string "Hello World" . The space character ' ' is treated like any other character in a regexp and is needed to match in this case. The lack of a space character is the reason the third regexp 'oW' doesn't match. The fourth regexp 'World ' doesn't match because there is a space at the end of the regexp, but not at the end of the string. The lesson here is that regexps must match a part of the string exactly in order for the statement to be true.

If a regexp matches in more than one place in the string, Perl will always match at the earliest possible point in the string:

    "Hello World" =~ /o/;       # matches 'o' in 'Hello'
    "That hat is red" =~ /hat/; # matches 'hat' in 'That'

With respect to character matching, there are a few more points you need to know about. First of all, not all characters can be used 'as is' in a match. Some characters, called metacharacters, are reserved for use in regexp notation. The metacharacters are

    {}[]()^$.|*+?\

The significance of each of these will be explained in the rest of the tutorial, but for now, it is important only to know that a metacharacter can be matched by putting a backslash before it:

    "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
    "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
    "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
    "The interval is [0,1)." =~ /\[0,1\)\./  # matches
    "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

In the last regexp, the forward slash '/' is also backslashed, because it is used to delimit the regexp. This can lead to LTS (leaning toothpick syndrome), however, and it is often more readable to change delimiters.

    "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

The backslash character '\' is a metacharacter itself and needs to be backslashed:

    'C:\WIN32' =~ /C:\\WIN/;   # matches

In addition to the metacharacters, there are some ASCII characters which don't have printable character equivalents and are instead represented by escape sequences. Common examples are \t for a tab, \n for a newline, \r for a carriage return and \a for a bell. If your string is better thought of as a sequence of arbitrary bytes, the octal escape sequence, e.g., \033 , or hexadecimal escape sequence, e.g., \x1B may be a more natural representation for your bytes. Here are some examples of escapes:

    "1000\t2000" =~ m(0\t2)   # matches
    "1000\n2000" =~ /0\n20/   # matches
    "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
    "cat"        =~ /\143\x61\x74/ # matches, but a weird way to spell cat

If you've been around Perl a while, all this talk of escape sequences may seem familiar. Similar escape sequences are used in double-quoted strings and in fact the regexps in Perl are mostly treated as double-quoted strings. This means that variables can be used in regexps as well. Just like double-quoted strings, the values of the variables in the regexp will be substituted in before the regexp is evaluated for matching purposes. So we have:

    $foo = 'house';
    'housecat' =~ /$foo/;      # matches
    'cathouse' =~ /cat$foo/;   # matches
    'housecat' =~ /${foo}cat/; # matches

So far, so good. With the knowledge above you can already perform searches with just about any literal string regexp you can dream up. Here is a very simple emulation of the Unix grep program:

    % cat > simple_grep
    #!/usr/bin/perl
    $regexp = shift;
    while (<>) {
        print if /$regexp/;
    }
    ^D

    % chmod +x simple_grep

    % simple_grep abba /usr/dict/words
    Babbage
    cabbage
    cabbages
    sabbath
    Sabbathize
    Sabbathizes
    sabbatical
    scabbard
    scabbards

This program is easy to understand. #!/usr/bin/perl is the standard way to invoke a perl program from the shell. $regexp = shift;  saves the first command line argument as the regexp to be used, leaving the rest of the command line arguments to be treated as files. while (<>)>>> loops over all the lines in all the files.  For each line, <code&nbsp;class="inline"><a&nbsp;class="l_k"&nbsp;href="functions/print.html">print</a>&nbsp;if&nbsp;<span&nbsp;class="q">/$regexp/</span><span&nbsp;class="sc">;</span></code>&nbsp; prints the line if the regexp matches the line.  In this line, both <code class="inline"><a class="l_k" href="functions/print.html">print</a></code> and <code class="inline"><span class="q">/$regexp/</span></code>  use the default variable <code class="inline"><span class="i">$_</span></code>  implicitly.

With all of the regexps above, if the regexp matched anywhere in the string, it was considered a match. Sometimes, however, we'd like to specify where in the string the regexp should try to match. To do this, we would use the anchor metacharacters ^ and $ . The anchor ^ means match at the beginning of the string and the anchor $ means match at the end of the string, or before a newline at the end of the string. Here is how they are used:

    "housekeeper" =~ /keeper/;    # matches
    "housekeeper" =~ /^keeper/;   # doesn't match
    "housekeeper" =~ /keeper$/;   # matches
    "housekeeper\n" =~ /keeper$/; # matches

The second regexp doesn't match because ^ constrains keeper to match only at the beginning of the string, but "housekeeper" has keeper starting in the middle. The third regexp does match, since the $ constrains keeper to match only at the end of the string.

When both ^ and $ are used at the same time, the regexp has to match both the beginning and the end of the string, i.e., the regexp matches the whole string. Consider

    "keeper" =~ /^keep$/;      # doesn't match
    "keeper" =~ /^keeper$/;    # matches
    ""       =~ /^$/;          # ^$ matches an empty string

The first regexp doesn't match because the string has more to it than keep . Since the second regexp is exactly the string, it matches. Using both ^ and $ in a regexp forces the complete string to match, so it gives you complete control over which strings match and which don't. Suppose you are looking for a fellow named bert, off in a string by himself:

    "dogbert" =~ /bert/;   # matches, but not what you want

    "dilbert" =~ /^bert/;  # doesn't match, but ..
    "bertram" =~ /^bert/;  # matches, so still not good enough

    "bertram" =~ /^bert$/; # doesn't match, good
    "dilbert" =~ /^bert$/; # doesn't match, good
    "bert"    =~ /^bert$/; # matches, perfect

Of course, in the case of a literal string, one could just as easily use the string comparison $string eq 'bert'  and it would be more efficient. The ^...$ regexp really becomes useful when we add in the more powerful regexp tools below.

Using character classes

Although one can already do quite a lot with the literal string regexps above, we've only scratched the surface of regular expression technology. In this and subsequent sections we will introduce regexp concepts (and associated metacharacter notations) that will allow a regexp to not just represent a single character sequence, but a whole class of them.

One such concept is that of a character class. A character class allows a set of possible characters, rather than just a single character, to match at a particular point in a regexp. Character classes are denoted by brackets [...] , with the set of characters to be possibly matched inside. Here are some examples:

    /cat/;       # matches 'cat'
    /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
    /item[0123456789]/;  # matches 'item0' or ... or 'item9'
    "abc" =~ /[cab]/;    # matches 'a'

In the last statement, even though 'c' is the first character in the class, 'a' matches because the first character position in the string is the earliest point at which the regexp can match.

    /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                         # 'yes', 'Yes', 'YES', etc.

This regexp displays a common task: perform a case-insensitive match. Perl provides a way of avoiding all those brackets by simply appending an 'i' to the end of the match. Then /[yY][eE][sS]/; can be rewritten as /yes/i; . The 'i' stands for case-insensitive and is an example of a modifier of the matching operation. We will meet other modifiers later in the tutorial.

We saw in the section above that there were ordinary characters, which represented themselves, and special characters, which needed a backslash \ to represent themselves. The same is true in a character class, but the sets of ordinary and special characters inside a character class are different than those outside a character class. The special characters for a character class are -]\^$ (and the pattern delimiter, whatever it is). ] is special because it denotes the end of a character class. $ is special because it denotes a scalar variable. \ is special because it is used in escape sequences, just like above. Here is how the special characters ]$\ are handled:

   /[\]c]def/; # matches ']def' or 'cdef'
   $x = 'bcr';
   /[$x]at/;   # matches 'bat', 'cat', or 'rat'
   /[\$x]at/;  # matches '$at' or 'xat'
   /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

The last two are a little tricky. In [\$x] , the backslash protects the dollar sign, so the character class has two members $ and x . In [\\$x] , the backslash is protected, so $x is treated as a variable and substituted in double quote fashion.

The special character '-' acts as a range operator within character classes, so that a contiguous set of characters can be written as a range. With ranges, the unwieldy [0123456789] and [abc...xyz] become the svelte [0-9] and [a-z] . Some examples are

    /item[0-9]/;  # matches 'item0' or ... or 'item9'
    /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                    # 'baa', 'xaa', 'yaa', or 'zaa'
    /[0-9a-fA-F]/;  # matches a hexadecimal digit
    /[0-9a-zA-Z_]/; # matches a "word" character,
                    # like those in a Perl variable name

If '-' is the first or last character in a character class, it is treated as an ordinary character; [-ab] , [ab-] and [a\-b] are all equivalent.

The special character ^ in the first position of a character class denotes a negated character class, which matches any character but those in the brackets. Both [...] and [^...] must match a character, or the match fails. Then

    /[^a]at/;  # doesn't match 'aat' or 'at', but matches
               # all other 'bat', 'cat, '0at', '%at', etc.
    /[^0-9]/;  # matches a non-numeric character
    /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

Now, even [0-9] can be a bother to write multiple times, so in the interest of saving keystrokes and making regexps more readable, Perl has several abbreviations for common character classes, as shown below. Since the introduction of Unicode, these character classes match more than just a few characters in the ISO 8859-1 range.

• \d matches a digit, not just [0-9] but also digits from non-roman scripts

• \s matches a whitespace character, the set [\ \t\r\n\f] and others

• \w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_] but also digits and characters from non-roman scripts

• \D is a negated \d; it represents any other character than a digit, or [^\d]

• \S is a negated \s; it represents any non-whitespace character [^\s]

• \W is a negated \w; it represents any non-word character [^\w]

• The period '.' matches any character but "\n" (unless the modifier //s is in effect, as explained below).

The \d\s\w\D\S\W abbreviations can be used both inside and outside of character classes. Here are some in use:

    /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
    /[\d\s]/;         # matches any digit or whitespace character
    /\w\W\w/;         # matches a word char, followed by a
                      # non-word char, followed by a word char
    /..rt/;           # matches any two chars, followed by 'rt'
    /end\./;          # matches 'end.'
    /end[.]/;         # same thing, matches 'end.'

Because a period is a metacharacter, it needs to be escaped to match as an ordinary period. Because, for example, \d and \w are sets of characters, it is incorrect to think of [^\d\w] as [\D\W] ; in fact [^\d\w] is the same as [^\w], which is the same as [\W] . Think DeMorgan's laws.

An anchor useful in basic regexps is the word anchor \b . This matches a boundary between a word character and a non-word character \w\W or \W\w :

    $x = "Housecat catenates house and cat";
    $x =~ /cat/;    # matches cat in 'housecat'
    $x =~ /\bcat/;  # matches cat in 'catenates'
    $x =~ /cat\b/;  # matches cat in 'housecat'
    $x =~ /\bcat\b/;  # matches 'cat' at end of string

Note in the last example, the end of the string is considered a word boundary.

You might wonder why '.' matches everything but "\n" - why not every character? The reason is that often one is matching against lines and would like to ignore the newline characters. For instance, while the string "\n" represents one line, we would like to think of it as empty. Then

    ""   =~ /^$/;    # matches
    "\n" =~ /^$/;    # matches, $ anchors before "\n"

    ""   =~ /./;      # doesn't match; it needs a char
    ""   =~ /^.$/;    # doesn't match; it needs a char
    "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
    "a"  =~ /^.$/;    # matches
    "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"

This behavior is convenient, because we usually want to ignore newlines when we count and match characters in a line. Sometimes, however, we want to keep track of newlines. We might even want ^ and $ to anchor at the beginning and end of lines within the string, rather than just the beginning and end of the string. Perl allows us to choose between ignoring and paying attention to newlines by using the //s and //m modifiers. //s and //m stand for single line and multi-line and they determine whether a string is to be treated as one continuous string, or as a set of lines. The two modifiers affect two aspects of how the regexp is interpreted: 1) how the '.' character class is defined, and 2) where the anchors ^ and $ are able to match. Here are the four possible combinations:

• no modifiers (//): Default behavior. '.' matches any character except "\n" . ^ matches only at the beginning of the string and $ matches only at the end or before a newline at the end.

• s modifier (//s): Treat string as a single long line. '.' matches any character, even "\n" . ^ matches only at the beginning of the string and $ matches only at the end or before a newline at the end.

• m modifier (//m): Treat string as a set of multiple lines. '.' matches any character except "\n" . ^ and $ are able to match at the start or end of any line within the string.

• both s and m modifiers (//sm): Treat string as a single long line, but detect multiple lines. '.' matches any character, even "\n" . ^ and $ , however, are able to match at the start or end of any line within the string.

Here are examples of //s and //m in action:

    $x = "There once was a girl\nWho programmed in Perl\n";

    $x =~ /^Who/;   # doesn't match, "Who" not at start of string
    $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
    $x =~ /^Who/m;  # matches, "Who" at start of second line
    $x =~ /^Who/sm; # matches, "Who" at start of second line

    $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
    $x =~ /girl.Who/s;  # matches, "." matches "\n"
    $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
    $x =~ /girl.Who/sm; # matches, "." matches "\n"

Most of the time, the default behavior is what is wanted, but //s and //m are occasionally very useful. If //m is being used, the start of the string can still be matched with \A and the end of the string can still be matched with the anchors \Z (matches both the end and the newline before, like $ ), and \z (matches only the end):

    $x =~ /^Who/m;   # matches, "Who" at start of second line
    $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

    $x =~ /girl$/m;  # matches, "girl" at end of first line
    $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

    $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
    $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

We now know how to create choices among classes of characters in a regexp. What about choices among words or character strings? Such choices are described in the next section.

Matching this or that

Sometimes we would like our regexp to be able to match different possible words or character strings. This is accomplished by using the alternation metacharacter |. To match dog or cat , we form the regexp dog|cat . As before, Perl will try to match the regexp at the earliest possible point in the string. At each character position, Perl will first try to match the first alternative, dog . If dog doesn't match, Perl will then try the next alternative, cat . If cat doesn't match either, then the match fails and Perl moves to the next position in the string. Some examples:

    "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
    "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

Even though dog is the first alternative in the second regexp, cat is able to match earlier in the string.

    "cats"          =~ /c|ca|cat|cats/; # matches "c"
    "cats"          =~ /cats|cat|ca|c/; # matches "cats"

Here, all the alternatives match at the first string position, so the first alternative is the one that matches. If some of the alternatives are truncations of the others, put the longest ones first to give them a chance to match.

    "cab" =~ /a|b|c/ # matches "c"
                     # /a|b|c/ == /[abc]/

The last example points out that character classes are like alternations of characters. At a given character position, the first alternative that allows the regexp match to succeed will be the one that matches.

Grouping things and hierarchical matching

Alternation allows a regexp to choose among alternatives, but by itself it is unsatisfying. The reason is that each alternative is a whole regexp, but sometime we want alternatives for just part of a regexp. For instance, suppose we want to search for housecats or housekeepers. The regexp housecat|housekeeper fits the bill, but is inefficient because we had to type house twice. It would be nice to have parts of the regexp be constant, like house , and some parts have alternatives, like cat|keeper .

The grouping metacharacters () solve this problem. Grouping allows parts of a regexp to be treated as a single unit. Parts of a regexp are grouped by enclosing them in parentheses. Thus we could solve the housecat|housekeeper by forming the regexp as house(cat|keeper) . The regexp house(cat|keeper) means match house followed by either cat or keeper . Some more examples are

    /(a|b)b/;    # matches 'ab' or 'bb'
    /(ac|b)b/;   # matches 'acb' or 'bb'
    /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
    /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

    /house(cat|)/;  # matches either 'housecat' or 'house'
    /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                        # 'house'.  Note groups can be nested.

    /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
    "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                             # because '20\d\d' can't match

Alternations behave the same way in groups as out of them: at a given string position, the leftmost alternative that allows the regexp to match is taken. So in the last example at the first string position, "20" matches the second alternative, but there is nothing left over to match the next two digits \d\d . So Perl moves on to the next alternative, which is the null alternative and that works, since "20" is two digits.

The process of trying one alternative, seeing if it matches, and moving on to the next alternative, while going back in the string from where the previous alternative was tried, if it doesn't, is called backtracking. The term 'backtracking' comes from the idea that matching a regexp is like a walk in the woods. Successfully matching a regexp is like arriving at a destination. There are many possible trailheads, one for each string position, and each one is tried in order, left to right. From each trailhead there may be many paths, some of which get you there, and some which are dead ends. When you walk along a trail and hit a dead end, you have to backtrack along the trail to an earlier point to try another trail. If you hit your destination, you stop immediately and forget about trying all the other trails. You are persistent, and only if you have tried all the trails from all the trailheads and not arrived at your destination, do you declare failure. To be concrete, here is a step-by-step analysis of what Perl does when it tries to match the regexp

    "abcde" =~ /(abd|abc)(df|d|de)/;

1. Start with the first letter in the string 'a'.

2. Try the first alternative in the first group 'abd'.

3. Match 'a' followed by 'b'. So far so good.

4. 'd' in the regexp doesn't match 'c' in the string - a dead end. So backtrack two characters and pick the second alternative in the first group 'abc'.

5. Match 'a' followed by 'b' followed by 'c'. We are on a roll and have satisfied the first group. Set $1 to 'abc'.

6. Move on to the second group and pick the first alternative 'df'.

7. Match the 'd'.

8. 'f' in the regexp doesn't match 'e' in the string, so a dead end. Backtrack one character and pick the second alternative in the second group 'd'.

9. 'd' matches. The second grouping is satisfied, so set $2 to 'd'.

10. We are at the end of the regexp, so we are done! We have matched 'abcd' out of the string "abcde".

There are a couple of things to note about this analysis. First, the third alternative in the second group 'de' also allows a match, but we stopped before we got to it - at a given character position, leftmost wins. Second, we were able to get a match at the first character position of the string 'a'. If there were no matches at the first position, Perl would move to the second character position 'b' and attempt the match all over again. Only when all possible paths at all possible character positions have been exhausted does Perl give up and declare $string =~ /(abd|abc)(df|d|de)/;  to be false.

Even with all this work, regexp matching happens remarkably fast. To speed things up, Perl compiles the regexp into a compact sequence of opcodes that can often fit inside a processor cache. When the code is executed, these opcodes can then run at full throttle and search very quickly.

Extracting matches

The grouping metacharacters () also serve another completely different function: they allow the extraction of the parts of a string that matched. This is very useful to find out what matched and for text processing in general. For each grouping, the part that matched inside goes into the special variables $1 , $2 , etc. They can be used just as ordinary variables:

    # extract hours, minutes, seconds
    if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
	$hours = $1;
	$minutes = $2;
	$seconds = $3;
    }

Now, we know that in scalar context, $time =~ /(\d\d):(\d\d):(\d\d)/  returns a true or false value. In list context, however, it returns the list of matched values ($1,$2,$3) . So we could write the code more compactly as

    # extract hours, minutes, seconds
    ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

If the groupings in a regexp are nested, $1 gets the group with the leftmost opening parenthesis, $2 the next opening parenthesis, etc. Here is a regexp with nested groups:

    /(ab(cd|ef)((gi)|j))/;
     1  2      34

If this regexp matches, $1 contains a string starting with 'ab' , $2 is either set to 'cd' or 'ef' , $3 equals either 'gi' or 'j' , and $4 is either set to 'gi' , just like $3 , or it remains undefined.

For convenience, Perl sets $+ to the string held by the highest numbered $1 , $2 ,... that got assigned (and, somewhat related, $^N to the value of the $1 , $2 ,... most-recently assigned; i.e. the $1 , $2 ,... associated with the rightmost closing parenthesis used in the match).

Backreferences

Closely associated with the matching variables $1 , $2 , ... are the backreferences \1 , \2 ,... Backreferences are simply matching variables that can be used inside a regexp. This is a really nice feature -- what matches later in a regexp is made to depend on what matched earlier in the regexp. Suppose we wanted to look for doubled words in a text, like 'the the'. The following regexp finds all 3-letter doubles with a space in between:

    /\b(\w\w\w)\s\1\b/;

The grouping assigns a value to \1, so that the same 3 letter sequence is used for both parts.

A similar task is to find words consisting of two identical parts:

    % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
    beriberi
    booboo
    coco
    mama
    murmur
    papa

The regexp has a single grouping which considers 4-letter combinations, then 3-letter combinations, etc., and uses \1 to look for a repeat. Although $1 and \1 represent the same thing, care should be taken to use matched variables $1 , $2 ,... only outside a regexp and backreferences \1 , \2 ,... only inside a regexp; not doing so may lead to surprising and unsatisfactory results.

Relative backreferences

Counting the opening parentheses to get the correct number for a backreference is errorprone as soon as there is more than one capturing group. A more convenient technique became available with Perl 5.10: relative backreferences. To refer to the immediately preceding capture group one now may write \g{-1} , the next but last is available via \g{-2} , and so on.

Another good reason in addition to readability and maintainability for using relative backreferences is illustrated by the following example, where a simple pattern for matching peculiar strings is used:

    $a99a = '([a-z])(\d)\2\1';   # matches a11a, g22g, x33x, etc.

Now that we have this pattern stored as a handy string, we might feel tempted to use it as a part of some other pattern:

    $line = "code=e99e";
    if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
        print "$1 is valid\n";
    } else {
        print "bad line: '$line'\n";
    }

But this doesn't match -- at least not the way one might expect. Only after inserting the interpolated $a99a and looking at the resulting full text of the regexp is it obvious that the backreferences have backfired -- the subexpression (\w+) has snatched number 1 and demoted the groups in $a99a by one rank. This can be avoided by using relative backreferences:

    $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being interpolated

Named backreferences

Perl 5.10 also introduced named capture buffers and named backreferences. To attach a name to a capturing group, you write either (?<name>...) or (?'name'...). The backreference may then be written as \g{name} . It is permissible to attach the same name to more than one group, but then only the leftmost one of the eponymous set can be referenced. Outside of the pattern a named capture buffer is accessible through the %+ hash.

Assuming that we have to match calendar dates which may be given in one of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write three suitable patterns where we use 'd', 'm' and 'y' respectively as the names of the buffers capturing the pertaining components of a date. The matching operation combines the three patterns as alternatives:

    $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
    $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
    $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
    for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
        if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
            print "day=$+{d} month=$+{m} year=$+{y}\n";
        }
    }

If any of the alternatives matches, the hash %+ is bound to contain the three key-value pairs.

Alternative capture group numbering

Yet another capturing group numbering technique (also as from Perl 5.10) deals with the problem of referring to groups within a set of alternatives. Consider a pattern for matching a time of the day, civil or military style:

    if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
        # process hour and minute
    }

Processing the results requires an additional if statement to determine whether $1 and $2 or $3 and $4 contain the goodies. It would be easier if we could use buffer numbers 1 and 2 in second alternative as well, and this is exactly what the parenthesized construct (?|...), set around an alternative achieves. Here is an extended version of the previous pattern:

    if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
	print "hour=$1 minute=$2 zone=$3\n";
    }

Within the alternative numbering group, buffer numbers start at the same position for each alternative. After the group, numbering continues with one higher than the maximum reached across all the alternatives.

Position information

In addition to what was matched, Perl (since 5.6.0) also provides the positions of what was matched as contents of the @- and @+ arrays. $-[0] is the position of the start of the entire match and $+[0] is the position of the end. Similarly, $-[n] is the position of the start of the $n match and $+[n] is the position of the end. If $n is undefined, so are $-[n] and $+[n] . Then this code

    $x = "Mmm...donut, thought Homer";
    $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
    foreach $expr (1..$#-) {
        print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
    }

prints

    Match 1: 'Mmm' at position (0,3)
    Match 2: 'donut' at position (6,11)

Even if there are no groupings in a regexp, it is still possible to find out what exactly matched in a string. If you use them, Perl will set $` to the part of the string before the match, will set $& to the part of the string that matched, and will set $' to the part of the string after the match. An example:

    $x = "the cat caught the mouse";
    $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
    $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

In the second match, $` equals '' because the regexp matched at the first character position in the string and stopped; it never saw the second 'the'. It is important to note that using $` and $' slows down regexp matching quite a bit, while $& slows it down to a lesser extent, because if they are used in one regexp in a program, they are generated for all regexps in the program. So if raw performance is a goal of your application, they should be avoided. If you need to extract the corresponding substrings, use @- and @+ instead:

    $` is the same as substr( $x, 0, $-[0] )
    $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
    $' is the same as substr( $x, $+[0] )

Non-capturing groupings

A group that is required to bundle a set of alternatives may or may not be useful as a capturing group. If it isn't, it just creates a superfluous addition to the set of available capture buffer values, inside as well as outside the regexp. Non-capturing groupings, denoted by (?:regexp), still allow the regexp to be treated as a single unit, but don't establish a capturing buffer at the same time. Both capturing and non-capturing groupings are allowed to co-exist in the same regexp. Because there is no extraction, non-capturing groupings are faster than capturing groupings. Non-capturing groupings are also handy for choosing exactly which parts of a regexp are to be extracted to matching variables:

    # match a number, $1-$4 are set, but we only want $1
    /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

    # match a number faster , only $1 is set
    /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

    # match a number, get $1 = whole number, $2 = exponent
    /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

Non-capturing groupings are also useful for removing nuisance elements gathered from a split operation where parentheses are required for some reason:

    $x = '12aba34ba5';
    @num = split /(a|b)+/, $x;    # @num = ('12','a','34','b','5')
    @num = split /(?:a|b)+/, $x;  # @num = ('12','34','5')

Matching repetitions

The examples in the previous section display an annoying weakness. We were only matching 3-letter words, or chunks of words of 4 letters or less. We'd like to be able to match words or, more generally, strings of any length, without writing out tedious alternatives like \w\w\w\w|\w\w\w|\w\w|\w .

This is exactly the problem the quantifier metacharacters ?, * , + , and {} were created for. They allow us to delimit the number of repeats for a portion of a regexp we consider to be a match. Quantifiers are put immediately after the character, character class, or grouping that we want to specify. They have the following meanings:

• a? means: match 'a' 1 or 0 times

• a* means: match 'a' 0 or more times, i.e., any number of times

• a+ means: match 'a' 1 or more times, i.e., at least once

• a{n,m} means: match at least n times, but not more than m times.

• a{n,} means: match at least n or more times

• a{n} means: match exactly n times

Here are some examples:

    /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                     # any number of digits
    /(\w+)\s+\1/;    # match doubled words of arbitrary length
    /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
    $year =~ /\d{2,4}/;  # make sure year is at least 2 but not more
                         # than 4 digits
    $year =~ /\d{4}|\d{2}/;    # better match; throw out 3 digit dates
    $year =~ /\d{2}(\d{2})?/;  # same thing written differently. However,
                               # this produces $1 and the other does not.

    % simple_grep '^(\w+)\1$' /usr/dict/words   # isn't this easier?
    beriberi
    booboo
    coco
    mama
    murmur
    papa

For all of these quantifiers, Perl will try to match as much of the string as possible, while still allowing the regexp to succeed. Thus with /a?.../ , Perl will first try to match the regexp with the a present; if that fails, Perl will try to match the regexp without the a present. For the quantifier * , we get the following:

    $x = "the cat in the hat";
    $x =~ /^(.*)(cat)(.*)$/; # matches,
                             # $1 = 'the '
                             # $2 = 'cat'
                             # $3 = ' in the hat'

Which is what we might expect, the match finds the only cat in the string and locks onto it. Consider, however, this regexp:

    $x =~ /^(.*)(at)(.*)$/; # matches,
                            # $1 = 'the cat in the h'
                            # $2 = 'at'
                            # $3 = ''   (0 characters match)

One might initially guess that Perl would find the at in cat and stop there, but that wouldn't give the longest possible string to the first quantifier .*. Instead, the first quantifier .* grabs as much of the string as possible while still having the regexp match. In this example, that means having the at sequence with the final at in the string. The other important principle illustrated here is that when there are two or more elements in a regexp, the leftmost quantifier, if there is one, gets to grab as much the string as possible, leaving the rest of the regexp to fight over scraps. Thus in our example, the first quantifier .* grabs most of the string, while the second quantifier .* gets the empty string. Quantifiers that grab as much of the string as possible are called maximal match or greedy quantifiers.

When a regexp can match a string in several different ways, we can use the principles above to predict which way the regexp will match:

• Principle 0: Taken as a whole, any regexp will be matched at the earliest possible position in the string.

• Principle 1: In an alternation a|b|c... , the leftmost alternative that allows a match for the whole regexp will be the one used.

• Principle 2: The maximal matching quantifiers ?, * , + and {n,m} will in general match as much of the string as possible while still allowing the whole regexp to match.

• Principle 3: If there are two or more elements in a regexp, the leftmost greedy quantifier, if any, will match as much of the string as possible while still allowing the whole regexp to match. The next leftmost greedy quantifier, if any, will try to match as much of the string remaining available to it as possible, while still allowing the whole regexp to match. And so on, until all the regexp elements are satisfied.

As we have seen above, Principle 0 overrides the others -- the regexp will be matched as early as possible, with the other principles determining how the regexp matches at that earliest character position.

Here is an example of these principles in action:

    $x = "The programming republic of Perl";
    $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                              # $1 = 'The programming republic of Pe'
                              # $2 = 'r'
                              # $3 = 'l'

This regexp matches at the earliest string position, 'T' . One might think that e , being leftmost in the alternation, would be matched, but r produces the longest string in the first quantifier.

    $x =~ /(m{1,2})(.*)$/;  # matches,
                            # $1 = 'mm'
                            # $2 = 'ing republic of Perl'

Here, The earliest possible match is at the first 'm' in programming . m{1,2} is the first quantifier, so it gets to match a maximal mm .

    $x =~ /.*(m{1,2})(.*)$/;  # matches,
                              # $1 = 'm'
                              # $2 = 'ing republic of Perl'

Here, the regexp matches at the start of the string. The first quantifier .* grabs as much as possible, leaving just a single 'm' for the second quantifier m{1,2}.

    $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                # $1 = 'a'
                                # $2 = 'mm'
                                # $3 = 'ing republic of Perl'

Here, .? eats its maximal one character at the earliest possible position in the string, 'a' in programming , leaving m{1,2} the opportunity to match both m's. Finally,

    "aXXXb" =~ /(X*)/; # matches with $1 = ''

because it can match zero copies of 'X' at the beginning of the string. If you definitely want to match at least one 'X' , use X+ , not X* .

Sometimes greed is not good. At times, we would like quantifiers to match a minimal piece of string, rather than a maximal piece. For this purpose, Larry Wall created the minimal match or non-greedy quantifiers ?? , *? , +?, and {}?. These are the usual quantifiers with a ? appended to them. They have the following meanings:

• a?? means: match 'a' 0 or 1 times. Try 0 first, then 1.

• a*? means: match 'a' 0 or more times, i.e., any number of times, but as few times as possible

• a+? means: match 'a' 1 or more times, i.e., at least once, but as few times as possible

• a{n,m}? means: match at least n times, not more than m times, as few times as possible

• a{n,}? means: match at least n times, but as few times as possible

• a{n}? means: match exactly n times. Because we match exactly n times, a{n}? is equivalent to a{n} and is just there for notational consistency.

Let's look at the example above, but with minimal quantifiers:

    $x = "The programming republic of Perl";
    $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                              # $1 = 'Th'
                              # $2 = 'e'
                              # $3 = ' programming republic of Perl'

The minimal string that will allow both the start of the string ^ and the alternation to match is Th , with the alternation e|r matching e . The second quantifier .* is free to gobble up the rest of the string.

    $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                              # $1 = 'm'
                              # $2 = 'ming republic of Perl'

The first string position that this regexp can match is at the first 'm' in programming . At this position, the minimal m{1,2}? matches just one 'm' . Although the second quantifier .*? would prefer to match no characters, it is constrained by the end-of-string anchor $ to match the rest of the string.

    $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                  # $1 = 'The progra'
                                  # $2 = 'm'
                                  # $3 = 'ming republic of Perl'

In this regexp, you might expect the first minimal quantifier .*? to match the empty string, because it is not constrained by a ^ anchor to match the beginning of the word. Principle 0 applies here, however. Because it is possible for the whole regexp to match at the start of the string, it will match at the start of the string. Thus the first quantifier has to match everything up to the first m. The second minimal quantifier matches just one m and the third quantifier matches the rest of the string.

    $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                 # $1 = 'a'
                                 # $2 = 'mm'
                                 # $3 = 'ing republic of Perl'

Just as in the previous regexp, the first quantifier .?? can match earliest at position 'a' , so it does. The second quantifier is greedy, so it matches mm , and the third matches the rest of the string.

We can modify principle 3 above to take into account non-greedy quantifiers:

• Principle 3: If there are two or more elements in a regexp, the leftmost greedy (non-greedy) quantifier, if any, will match as much (little) of the string as possible while still allowing the whole regexp to match. The next leftmost greedy (non-greedy) quantifier, if any, will try to match as much (little) of the string remaining available to it as possible, while still allowing the whole regexp to match. And so on, until all the regexp elements are satisfied.

Just like alternation, quantifiers are also susceptible to backtracking. Here is a step-by-step analysis of the example

    $x = "the cat in the hat";
    $x =~ /^(.*)(at)(.*)$/; # matches,
                            # $1 = 'the cat in the h'
                            # $2 = 'at'
                            # $3 = ''   (0 matches)

1. Start with the first letter in the string 't'.

2. The first quantifier '.*' starts out by matching the whole string 'the cat in the hat'.

3. 'a' in the regexp element 'at' doesn't match the end of the string. Backtrack one character.

4. 'a' in the regexp element 'at' still doesn't match the last letter of the string 't', so backtrack one more character.

5. Now we can match the 'a' and the 't'.

6. Move on to the third element '.*'. Since we are at the end of the string and '.*' can match 0 times, assign it the empty string.

7. We are done!

Most of the time, all this moving forward and backtracking happens quickly and searching is fast. There are some pathological regexps, however, whose execution time exponentially grows with the size of the string. A typical structure that blows up in your face is of the form

    /(a|b+)*/;

The problem is the nested indeterminate quantifiers. There are many different ways of partitioning a string of length n between the + and * : one repetition with b+ of length n, two repetitions with the first b+ length k and the second with length n-k, m repetitions whose bits add up to length n, etc. In fact there are an exponential number of ways to partition a string as a function of its length. A regexp may get lucky and match early in the process, but if there is no match, Perl will try every possibility before giving up. So be careful with nested * 's, {n,m}'s, and + 's. The book Mastering Regular Expressions by Jeffrey Friedl gives a wonderful discussion of this and other efficiency issues.

Possessive quantifiers

Backtracking during the relentless search for a match may be a waste of time, particularly when the match is bound to fail. Consider the simple pattern

    /^\w+\s+\w+$/; # a word, spaces, a word

Whenever this is applied to a string which doesn't quite meet the pattern's expectations such as "abc  "  or "abc  def " , the regex engine will backtrack, approximately once for each character in the string. But we know that there is no way around taking all of the initial word characters to match the first repetition, that all spaces must be eaten by the middle part, and the same goes for the second word.

With the introduction of the possessive quantifiers in Perl 5.10, we have a way of instructing the regex engine not to backtrack, with the usual quantifiers with a + appended to them. This makes them greedy as well as stingy; once they succeed they won't give anything back to permit another solution. They have the following meanings:

• a{n,m}+ means: match at least n times, not more than m times, as many times as possible, and don't give anything up. a?+ is short for a{0,1}+

• a{n,}+ means: match at least n times, but as many times as possible, and don't give anything up. a*+ is short for a{0,}+ and a++ is short for a{1,}+ .

• a{n}+ means: match exactly n times. It is just there for notational consistency.

These possessive quantifiers represent a special case of a more general concept, the independent subexpression, see below.

As an example where a possessive quantifier is suitable we consider matching a quoted string, as it appears in several programming languages. The backslash is used as an escape character that indicates that the next character is to be taken literally, as another character for the string. Therefore, after the opening quote, we expect a (possibly empty) sequence of alternatives: either some character except an unescaped quote or backslash or an escaped character.

    /"(?:[^"\\]++|\\.)*+"/;

Building a regexp

At this point, we have all the basic regexp concepts covered, so let's give a more involved example of a regular expression. We will build a regexp that matches numbers.

The first task in building a regexp is to decide what we want to match and what we want to exclude. In our case, we want to match both integers and floating point numbers and we want to reject any string that isn't a number.

The next task is to break the problem down into smaller problems that are easily converted into a regexp.

The simplest case is integers. These consist of a sequence of digits, with an optional sign in front. The digits we can represent with \d+ and the sign can be matched with [+-] . Thus the integer regexp is

    /[+-]?\d+/;  # matches integers

A floating point number potentially has a sign, an integral part, a decimal point, a fractional part, and an exponent. One or more of these parts is optional, so we need to check out the different possibilities. Floating point numbers which are in proper form include 123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out front is completely optional and can be matched by [+-]?. We can see that if there is no exponent, floating point numbers must have a decimal point, otherwise they are integers. We might be tempted to model these with \d*\.\d*, but this would also match just a single decimal point, which is not a number. So the three cases of floating point number without exponent are

   /[+-]?\d+\./;  # 1., 321., etc.
   /[+-]?\.\d+/;  # .1, .234, etc.
   /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

These can be combined into a single regexp with a three-way alternation:

   /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

In this alternation, it is important to put '\d+\.\d+' before '\d+\.' . If '\d+\.' were first, the regexp would happily match that and ignore the fractional part of the number.

Now consider floating point numbers with exponents. The key observation here is that both integers and numbers with decimal points are allowed in front of an exponent. Then exponents, like the overall sign, are independent of whether we are matching numbers with or without decimal points, and can be 'decoupled' from the mantissa. The overall form of the regexp now becomes clear:

    /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

The exponent is an e or E , followed by an integer. So the exponent regexp is

   /[eE][+-]?\d+/;  # exponent

Putting all the parts together, we get a regexp that matches numbers:

   /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

Long regexps like this may impress your friends, but can be hard to decipher. In complex situations like this, the //x modifier for a match is invaluable. It allows one to put nearly arbitrary whitespace and comments into a regexp without affecting their meaning. Using it, we can rewrite our 'extended' regexp in the more pleasing form

   /^
            [+-]?         # first, match an optional sign
            (             # then match integers or f.p. mantissas:
                    \d+\.\d+  # mantissa of the form a.b
                  |\d+\.     # mantissa of the form a.
                  |\.\d+     # mantissa of the form .b
                  |\d+       # integer of the form a
            )
            ([eE][+-]?\d+)?  # finally, optionally match an exponent
      $/x;

If whitespace is mostly irrelevant, how does one include space characters in an extended regexp? The answer is to backslash it '\ '  or put it in a character class [ ] . The same thing goes for pound signs, use \# or [#]. For instance, Perl allows a space between the sign and the mantissa or integer, and we could add this to our regexp as follows:

   /^
            [+-]?\ *      # first, match an optional sign *and space*
            (             # then match integers or f.p. mantissas:
                    \d+\.\d+  # mantissa of the form a.b
                  |\d+\.     # mantissa of the form a.
                  |\.\d+     # mantissa of the form .b
                  |\d+       # integer of the form a
            )
            ([eE][+-]?\d+)?  # finally, optionally match an exponent
      $/x;

In this form, it is easier to see a way to simplify the alternation. Alternatives 1, 2, and 4 all start with \d+ , so it could be factored out:

   /^
            [+-]?\ *      # first, match an optional sign
            (             # then match integers or f.p. mantissas:
                    \d+       # start out with a ...
                    (
                            \.\d* # mantissa of the form a.b or a.
                    )?        # ? takes care of integers of the form a
                  |\.\d+     # mantissa of the form .b
            )
            ([eE][+-]?\d+)?  # finally, optionally match an exponent
      $/x;

or written in the compact form,

    /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

This is our final regexp. To recap, we built a regexp by

• specifying the task in detail,

• breaking down the problem into smaller parts,

• translating the small parts into regexps,

• combining the regexps,

• and optimizing the final combined regexp.

These are also the typical steps involved in writing a computer program. This makes perfect sense, because regular expressions are essentially programs written in a little computer language that specifies patterns.

Using regular expressions in Perl

The last topic of Part 1 briefly covers how regexps are used in Perl programs. Where do they fit into Perl syntax?

We have already introduced the matching operator in its default /regexp/ and arbitrary delimiter m!regexp! forms. We have used the binding operator =~ and its negation !~ to test for string matches. Associated with the matching operator, we have discussed the single line //s , multi-line //m , case-insensitive //i and extended //x modifiers. There are a few more things you might want to know about matching operators.

Optimizing pattern evaluation

We pointed out earlier that variables in regexps are substituted before the regexp is evaluated:

    $pattern = 'Seuss';
    while (<>) {
        print if /$pattern/;
    }

This will print any lines containing the word Seuss . It is not as efficient as it could be, however, because Perl has to re-evaluate (or compile) $pattern each time through the loop. If $pattern won't be changing over the lifetime of the script, we can add the //o modifier, which directs Perl to only perform variable substitutions once:

    #!/usr/bin/perl
    #    Improved simple_grep
    $regexp = shift;
    while (<>) {
        print if /$regexp/o;  # a good deal faster
    }

Prohibiting substitution

If you change $pattern after the first substitution happens, Perl will ignore it. If you don't want any substitutions at all, use the special delimiter m'':

    @pattern = ('Seuss');
    while (<>) {
        print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
    }

Similar to strings, m'' acts like apostrophes on a regexp; all other m delimiters act like quotes. If the regexp evaluates to the empty string, the regexp in the last successful match is used instead. So we have

    "dog" =~ /d/;  # 'd' matches
    "dogbert =~ //;  # this matches the 'd' regexp used before

Global matching

The final two modifiers //g and //c concern multiple matches. The modifier //g stands for global matching and allows the matching operator to match within a string as many times as possible. In scalar context, successive invocations against a string will have `//g jump from match to match, keeping track of position in the string as it goes along. You can get or set the position with the pos() function.

The use of //g is shown in the following example. Suppose we have a string that consists of words separated by spaces. If we know how many words there are in advance, we could extract the words using groupings:

    $x = "cat dog house"; # 3 words
    $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                           # $1 = 'cat'
                                           # $2 = 'dog'
                                           # $3 = 'house'

But what if we had an indeterminate number of words? This is the sort of task //g was made for. To extract all words, form the simple regexp (\w+) and loop over all matches with /(\w+)/g :

    while ($x =~ /(\w+)/g) {
        print "Word is $1, ends at position ", pos $x, "\n";
    }

prints

    Word is cat, ends at position 3
    Word is dog, ends at position 7
    Word is house, ends at position 13

A failed match or changing the target string resets the position. If you don't want the position reset after failure to match, add the //c , as in /regexp/gc . The current position in the string is associated with the string, not the regexp. This means that different strings have different positions and their respective positions can be set or read independently.

In list context, //g returns a list of matched groupings, or if there are no groupings, a list of matches to the whole regexp. So if we wanted just the words, we could use

    @words = ($x =~ /(\w+)/g);  # matches,
                                # $word[0] = 'cat'
                                # $word[1] = 'dog'
                                # $word[2] = 'house'

Closely associated with the //g modifier is the \G anchor. The \G anchor matches at the point where the previous //g match left off. \G allows us to easily do context-sensitive matching:

    $metric = 1;  # use metric units
    ...
    $x = <FILE>;  # read in measurement
    $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
    $weight = $1;
    if ($metric) { # error checking
        print "Units error!" unless $x =~ /\Gkg\./g;
    }
    else {
        print "Units error!" unless $x =~ /\Glbs\./g;
    }
    $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

The combination of //g and \G allows us to process the string a bit at a time and use arbitrary Perl logic to decide what to do next. Currently, the \G anchor is only fully supported when used to anchor to the start of the pattern.

\G is also invaluable in processing fixed length records with regexps. Suppose we have a snippet of coding region DNA, encoded as base pair letters ATCGTTGAAT... and we want to find all the stop codons TGA . In a coding region, codons are 3-letter sequences, so we can think of the DNA snippet as a sequence of 3-letter records. The naive regexp

    # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
    $dna = "ATCGTTGAATGCAAATGACATGAC";
    $dna =~ /TGA/;

doesn't work; it may match a TGA , but there is no guarantee that the match is aligned with codon boundaries, e.g., the substring GTT GAA  gives a match. A better solution is

    while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
        print "Got a TGA stop codon at position ", pos $dna, "\n";
    }

which prints

    Got a TGA stop codon at position 18
    Got a TGA stop codon at position 23

Position 18 is good, but position 23 is bogus. What happened?

The answer is that our regexp works well until we get past the last real match. Then the regexp will fail to match a synchronized TGA and start stepping ahead one character position at a time, not what we want. The solution is to use \G to anchor the match to the codon alignment:

    while ($dna =~ /\G(\w\w\w)*?TGA/g) {
        print "Got a TGA stop codon at position ", pos $dna, "\n";
    }

This prints

    Got a TGA stop codon at position 18

which is the correct answer. This example illustrates that it is important not only to match what is desired, but to reject what is not desired.

Search and replace

Regular expressions also play a big role in search and replace operations in Perl. Search and replace is accomplished with the s/// operator. The general form is s/regexp/replacement/modifiers, with everything we know about regexps and modifiers applying in this case as well. The replacement is a Perl double quoted string that replaces in the string whatever is matched with the regexp . The operator =~ is also used here to associate a string with s///. If matching against $_ , the $_ =~  can be dropped. If there is a match, s/// returns the number of substitutions made, otherwise it returns false. Here are a few examples:

    $x = "Time to feed the cat!";
    $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
    if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
        $more_insistent = 1;
    }
    $y = "'quoted words'";
    $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                           # $y contains "quoted words"

In the last example, the whole string was matched, but only the part inside the single quotes was grouped. With the s/// operator, the matched variables $1 , $2 , etc. are immediately available for use in the replacement expression, so we use $1 to replace the quoted string with just what was quoted. With the global modifier, s///g will search and replace all occurrences of the regexp in the string:

    $x = "I batted 4 for 4";
    $x =~ s/4/four/;   # doesn't do it all:
                       # $x contains "I batted four for 4"
    $x = "I batted 4 for 4";
    $x =~ s/4/four/g;  # does it all:
                       # $x contains "I batted four for four"

If you prefer 'regex' over 'regexp' in this tutorial, you could use the following program to replace it:

    % cat > simple_replace
    #!/usr/bin/perl
    $regexp = shift;
    $replacement = shift;
    while (<>) {
        s/$regexp/$replacement/go;
        print;
    }
    ^D

    % simple_replace regexp regex perlretut.pod

In simple_replace we used the s///g modifier to replace all occurrences of the regexp on each line and the s///o modifier to compile the regexp only once. As with simple_grep , both the print and the s/$regexp/$replacement/go use $_ implicitly.

A modifier available specifically to search and replace is the s///e evaluation modifier. s///e wraps an eval{...} around the replacement string and the evaluated result is substituted for the matched substring. s///e is useful if you need to do a bit of computation in the process of replacing text. This example counts character frequencies in a line:

    $x = "Bill the cat";
    $x =~ s/(.)/$chars{$1}++;$1/eg;  # final $1 replaces char with itself
    print "frequency of '$_' is $chars{$_}\n"
        foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

This prints

    frequency of ' ' is 2
    frequency of 't' is 2
    frequency of 'l' is 2
    frequency of 'B' is 1
    frequency of 'c' is 1
    frequency of 'e' is 1
    frequency of 'h' is 1
    frequency of 'i' is 1
    frequency of 'a' is 1

As with the match m// operator, s/// can use other delimiters, such as s!!! and s{}{}, and even s{}//. If single quotes are used s''', then the regexp and replacement are treated as single quoted strings and there are no substitutions. s/// in list context returns the same thing as in scalar context, i.e., the number of matches.

The split function

The split() function is another place where a regexp is used.